| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.217337 |
| Chromosome: | chromosome 12 |
| Location: | 8122160 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g551350 | LAO2 | (1 of 1) 3.5.99.5 - 2-aminomuconate deaminase; Periplasmic L-amino acid oxidase, accessory subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAAACCGCACGTGTCACCTCTCCTGTG |
| Internal bar code: | GGGAGGGGGCCCATCGCCAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 405 |
| LEAP-Seq percent confirming: | 77.6847 |
| LEAP-Seq n confirming: | 1483 |
| LEAP-Seq n nonconfirming: | 426 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTACTTCCTTGGTGTGGC |
| Suggested primer 2: | GCCCTGGTAATCGACTGTGT |