| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217395 |
| Chromosome: | chromosome 3 |
| Location: | 1517911 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g152050 | GOX20,GOX12 | Glyoxal oxidase 12; (1 of 2) IPR009880//IPR011043//IPR013783//IPR014756//IPR015202//IPR015916 - Glyoxal oxidase, N-terminal // Galactose oxidase/kelch, beta-propeller // Immunoglobulin-like fold // Immunoglobulin E-set // Domain of unknown function DUF1929 // Galactose oxidase, beta-propeller | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTACCTGTGTGTGTGCGTGTGTTACATAG |
| Internal bar code: | CAGGTCGCCCTGAGGGCTGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 168 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 307 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATGTTCCGTTCGTGCATA |
| Suggested primer 2: | TGCCATCAGTGAGATGAAGC |