Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.217415 |
Chromosome: | chromosome 12 |
Location: | 7481342 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g556100 | DNAAF13,SPAG1 | Sperm-associated antigen 1; (1 of 1) PF00515//PF07719//PF13414//PF13877 - Tetratricopeptide repeat (TPR_1) // Tetratricopeptide repeat (TPR_2) // TPR repeat (TPR_11) // Potential Monad-binding region of RPAP3 (RPAP3_C) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGCCGCCGCGAGCGCGTTCACCACCGC |
Internal bar code: | CATCGATATTATTGATGGTAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 311 |
LEAP-Seq percent confirming: | 99.7204 |
LEAP-Seq n confirming: | 7489 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAGCCATGACCAATCCTC |
Suggested primer 2: | TAGGCCAACCCAGTTGAGTC |