| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.217471 |
| Chromosome: | chromosome 6 |
| Location: | 7734240 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g302050 | GSL2,BGS5,BGS6,GTR12 | Glucan synthase-like 2; (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTGTACGCCACCGGCCCCGGCCACTTC |
| Internal bar code: | TGTATTTGCTCTCATTTAATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5 |
| LEAP-Seq percent confirming: | 91.3341 |
| LEAP-Seq n confirming: | 801 |
| LEAP-Seq n nonconfirming: | 76 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACGC |
| Suggested primer 2: | AAGCTGTTCAGCATGACACG |