| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217498 |
| Chromosome: | chromosome 7 |
| Location: | 2601688 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330100 | GTR25,STT3B | (1 of 1) PTHR13872//PTHR13872:SF23 - 60S RIBOSOMAL PROTEIN L35 // DOLICHYL-DIPHOSPHOOLIGOSACCHARIDE--PROTEIN GLYCOSYLTRANSFERASE SUBUNIT STT3B; Staurosporin and temperature sensitive 3-like B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACTAAACGAACCCTGCGTGACTGGCCAT |
| Internal bar code: | ACAGGTCTGTAACCCTGCGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 36 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 152 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCCAGCAGAGTCCAGAAG |
| Suggested primer 2: | TTCATCTCCAACCTCATCCC |