Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.217500 |
Chromosome: | chromosome 4 |
Location: | 1239080 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g215250 | FAP26 | Ankyrin Repeat Flagellar Associated Protein 26; (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGAGAAAGTTTTGATAGCATACCTCTTG |
Internal bar code: | CGCCCAACGTGACGGCTGTCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 740 |
LEAP-Seq percent confirming: | 99.7378 |
LEAP-Seq n confirming: | 6846 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGTGGGTATGACATCGTG |
Suggested primer 2: | GCTGCAGACGTGATAGTCCA |