| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.217521 |
| Chromosome: | chromosome 1 |
| Location: | 3457767 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021950 | (1 of 1) PF08393//PF12777//PF12781 - Dynein heavy chain, N-terminal region 2 (DHC_N2) // Microtubule-binding stalk of dynein motor (MT) // ATP-binding dynein motor region D5 (AAA_9) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTCTATTGTTGTTGCGGCTTGGTGGTC |
| Internal bar code: | AAAGGGTACACTCATGTAGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 732 |
| LEAP-Seq percent confirming: | 93.4565 |
| LEAP-Seq n confirming: | 10469 |
| LEAP-Seq n nonconfirming: | 733 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGTCACCCACCTCAAGAC |
| Suggested primer 2: | TCAGACAGGGCTGTGCATAC |