| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217545 |
| Chromosome: | chromosome 7 |
| Location: | 1687099 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325550 | KDG3 | Diacylglycerol kinase; (1 of 2) K00901 - diacylglycerol kinase (ATP) (dgkA, DGK) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGACCGGCTGCCAGCCCGCCGCCTCGC |
| Internal bar code: | TTAGTACAGGCTTGTTATGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 864 |
| LEAP-Seq percent confirming: | 99.7049 |
| LEAP-Seq n confirming: | 3041 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGTAGCCCCACCACCTAC |
| Suggested primer 2: | CGACAAGAAAGGTGGCTCTC |