| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.217633 |
| Chromosome: | chromosome 2 |
| Location: | 1233094 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g082400 | (1 of 2) IPR000104//IPR001394//IPR028889 - Antifreeze protein, type I // Peptidase C19, ubiquitin carboxyl-terminal hydrolase // Ubiquitin specific protease domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTACGAACCACTGCCGCGCTGCCCGCC |
| Internal bar code: | CCGTCTTCAGAGCCTTGTTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 17 |
| LEAP-Seq percent confirming: | 92.4051 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACTTTTTACGCAGCAAC |
| Suggested primer 2: | CTGTGCCCTCTACTGAAGCC |