| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217644 |
| Chromosome: | chromosome 1 |
| Location: | 2765497 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016450 | (1 of 1) IPR000104//IPR001214//IPR002893 - Antifreeze protein, type I // SET domain // Zinc finger, MYND-type; SET domain protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAGCAACCCTCCTCCTTACGGCCCGTG |
| Internal bar code: | TGTCCAGGGAAATAGGACGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 368 |
| LEAP-Seq percent confirming: | 79.731 |
| LEAP-Seq n confirming: | 12627 |
| LEAP-Seq n nonconfirming: | 3210 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGACCACCGATGTTGTG |
| Suggested primer 2: | CGGTTACAGTGGCAGTAGCA |