| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.217686 |
| Chromosome: | chromosome 1 |
| Location: | 3170636 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g019850 | YTA10,FHL3,FTSH3 | FtsH-like ATPase/metalloprotease; (1 of 1) K08956 - AFG3 family protein [EC:3.4.24.-] (AFG3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAAGGAGGGCAAGGAGGGCGAGGGCAAG |
| Internal bar code: | CTGAATCACCTGCACTCGCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 86.1514 |
| LEAP-Seq n confirming: | 535 |
| LEAP-Seq n nonconfirming: | 86 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCTATGAATGCAAGGCCC |
| Suggested primer 2: | ATTGTACAGAGGCGGTGGAC |