| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217752 |
| Chromosome: | chromosome 15 |
| Location: | 435522 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g636350 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAAGGTCTGAGGGGAGGCACAGAGCATAC |
| Internal bar code: | GCTGAATGGTTATCAGAAGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1003 |
| LEAP-Seq percent confirming: | 98.8794 |
| LEAP-Seq n confirming: | 9706 |
| LEAP-Seq n nonconfirming: | 110 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCCTGAACACCTGAAACC |
| Suggested primer 2: | ATGGACCGTCAAAGTTCAGG |