| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217754 |
| Chromosome: | chromosome 1 |
| Location: | 2621044 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015250 | POLD1,DIV45 | DNA polymerase delta, catalytic subunit; (1 of 2) K02327 - DNA polymerase delta subunit 1 (POLD1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGCCTCCATGTACACCGCCAGGGCAACC |
| Internal bar code: | CCCCGAGCCGGTATCTCCTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1033 |
| LEAP-Seq percent confirming: | 99.0093 |
| LEAP-Seq n confirming: | 3298 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACAAGGCCAAAAACAAG |
| Suggested primer 2: | GGAATACTGGGTGTGAGCGT |