| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.217763 |
| Chromosome: | chromosome 4 |
| Location: | 3505561 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228000 | (1 of 1) PF13890 - Rab3 GTPase-activating protein catalytic subunit (Rab3-GTPase_cat) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATGCAACAGCGAGTGGCGCAGTGCCGG |
| Internal bar code: | AGGTTTGTTTAGGGCCCCGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 610 |
| LEAP-Seq percent confirming: | 99.2248 |
| LEAP-Seq n confirming: | 256 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACACACACGTGCACACACC |
| Suggested primer 2: | CTCCTCTTCACCGTCGTTGT |