Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.217864 |
Chromosome: | chromosome 16 |
Location: | 5635748 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g679550 | FAP277 | Flagellar Associated Protein 277; (1 of 1) K13963 - serpin B (SERPINB) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAGGGGTTCTGGACGCACGCCTTCAAG |
Internal bar code: | GCGGACTGCATGCGGGAGCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 722 |
LEAP-Seq percent confirming: | 99.7587 |
LEAP-Seq n confirming: | 11160 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTAGTTCGTCATCCCCTCA |
Suggested primer 2: | TTCTTAGCCCCATGAGCATC |