Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.217901 |
Chromosome: | chromosome 3 |
Location: | 4322470 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g174900 | (1 of 5) PF00536 - SAM domain (Sterile alpha motif) (SAM_1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCGCCCGAGGCGCGTCTTGTCCTTGGCG |
Internal bar code: | TTCTCGGTCGTTACCCACTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 692 |
LEAP-Seq percent confirming: | 99.7898 |
LEAP-Seq n confirming: | 1424 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGTCTGACCCGTTTCCAG |
Suggested primer 2: | AGAACTGCTCCACCTCCTCA |