| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.218029 |
| Chromosome: | chromosome 17 |
| Location: | 4543153 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g732700 | CUT2,CUTC,CUTC1 | (1 of 1) K06201 - copper homeostasis protein (cutC); Copper homeostasis protein cutC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCTATTAAATTGTTAACGCAGGTTATGC |
| Internal bar code: | GTTCAGCTGCGCGCCTGCGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 99.6495 |
| LEAP-Seq n confirming: | 9097 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCGCATAATAGCCCACAT |
| Suggested primer 2: | CTGGAAAAGTGGAAAGCTGC |