| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.218107 |
| Chromosome: | chromosome 1 |
| Location: | 976775 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005450 | RSP10 | (1 of 14) PF02493 - MORN repeat (MORN); Radial spoke protein 10 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTACGATAGGCATTCGGCGCTTCACATA |
| Internal bar code: | CTCGGACGCACGTTGCAATTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 79 |
| LEAP-Seq percent confirming: | 96.875 |
| LEAP-Seq n confirming: | 62 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTACCAACTTGACAGGGGC |
| Suggested primer 2: | GATACCCACCTGACGTTGCT |