| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.218110 |
| Chromosome: | chromosome 9 |
| Location: | 1097582 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400400 | (1 of 1) IPR002809//IPR008568 - Protein of unknown function DUF106, transmembrane // Uncharacterised conserved protein UCP010045, transmembrane eukaryotic | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCCTGCTAAAATGGCGGCAGGCCACTC |
| Internal bar code: | ACAGGCCATGCTCTGCTCCACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 99.5643 |
| LEAP-Seq n confirming: | 6627 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGCGCGGGAATATAACAG |
| Suggested primer 2: | AGGTCATGTCCCAAGGTCAG |