Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.218152 |
Chromosome: | chromosome 3 |
Location: | 1626478 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g152850 | PAM,PAM1 | (1 of 1) 1.14.17.3//4.3.2.5 - Peptidylglycine monooxygenase / Peptidylglycine alpha-amidating monooxygenase // Peptidylamidoglycolate lyase / Alpha-hydroxyglycine amidating dealkylase; bioactive peptide amidating enzyme | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTGTTGGCACCGAGCGCTGATGTATGCC |
Internal bar code: | TGATGCAGGCCAACCGGGAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 938 |
LEAP-Seq percent confirming: | 98.3107 |
LEAP-Seq n confirming: | 2386 |
LEAP-Seq n nonconfirming: | 41 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCTGTAGCGAGCTTTCCTG |
Suggested primer 2: | GCGTGTAAAGTGCTTGGTGA |