| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.218167 |
| Chromosome: | chromosome 5 |
| Location: | 368445 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g233100 | KIN14-6,KIN14B,KIN14B-1 | (1 of 3) K10406 - kinesin family member C2/C3 (KIFC2_3); Kinesin motor protein | 5'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTGCATGAGGCATAGGTACGACGGCGG |
| Internal bar code: | CAGCTCGCTCGGGCGGCACCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 817 |
| LEAP-Seq percent confirming: | 99.5902 |
| LEAP-Seq n confirming: | 243 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCTCCACAACGAGCAGGT |
| Suggested primer 2: | CTGACACCTAACCTCGGGAA |