Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.218167 |
Chromosome: | chromosome 5 |
Location: | 368843 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g233100 | KIN14-6,KIN14B,KIN14B-1 | (1 of 3) K10406 - kinesin family member C2/C3 (KIFC2_3); Kinesin motor protein | 5'UTR|5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGCCCGTGCAGAGGCATAGCTACTTAG |
Internal bar code: | ATAAGCGCCAGAGGAGGTTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 99.7849 |
LEAP-Seq n confirming: | 464 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAAATGTCGCTGCTCCTGT |
Suggested primer 2: | CCGTCGTACCTATGCCTCAT |