Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.218207 |
Chromosome: | chromosome 2 |
Location: | 252604 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g074850 | (1 of 19) K08850 - aurora kinase, other [EC:2.7.11.1] (AURKX) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATCCTCTAGGGTCCCATGTTGCCCTGCC |
Internal bar code: | AATTGCCTCAAGGGCGCTGTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1008 |
LEAP-Seq percent confirming: | 98.9575 |
LEAP-Seq n confirming: | 7214 |
LEAP-Seq n nonconfirming: | 76 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGAAAACCCGCTCCTTCT |
Suggested primer 2: | ACCTGCTCACGACCAATACC |