| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.218492 |
| Chromosome: | chromosome 15 |
| Location: | 1737580 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g643600 | SUF2,SUFB1,SUFB | Iron-sulfur cluster assembly protein; (1 of 1) PTHR30508//PTHR30508:SF1 - FES CLUSTER ASSEMBLY PROTEIN SUF // UPF0051 PROTEIN ABCI8, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGAGGAGACTTGCTTTTCCGAACCACTG |
| Internal bar code: | GTGTGCTCAGGGGTAGTATCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1025 |
| LEAP-Seq percent confirming: | 99.0247 |
| LEAP-Seq n confirming: | 7310 |
| LEAP-Seq n nonconfirming: | 72 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAACATGGCGGTGTAGGT |
| Suggested primer 2: | AAAGCACTTCGCTACCAGGA |