| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.218536 |
| Chromosome: | chromosome 16 |
| Location: | 1191748 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650650 | AGT3 | Alanine-glyoxylate aminotransferase; (1 of 1) 4.2.3.2 - Ethanolamine-phosphate phospho-lyase / O-phosphorylethanol-amine phospho-lyase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGGGCAGTGGTACAGGGAAAGAGGGGG |
| Internal bar code: | CCACTACTCAGGTCCCGGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 157 |
| LEAP-Seq percent confirming: | 96.3277 |
| LEAP-Seq n confirming: | 1023 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGGTTCGGGTTTAGTTTG |
| Suggested primer 2: | AGGTACGAGCCGCTACAGAA |