| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.218543 |
| Chromosome: | chromosome 17 |
| Location: | 6123232 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741500 | KIL7 | Putative kinesin-like motor protein; (1 of 1) 3.4.21.72//3.6.4.4 - IgA-specific serine endopeptidase / Immunoglobulin A1 protease // Plus-end-directed kinesin ATPase / Kinesin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGTTTGGTCGAAGAACCCTTGGTGCGGC |
| Internal bar code: | ACGGCGTACACCAGGTCTTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 971 |
| LEAP-Seq percent confirming: | 99.5843 |
| LEAP-Seq n confirming: | 5749 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGAGATCGTTCAAGATGGG |
| Suggested primer 2: | CGCCAGGTTGGTGTACTTTT |