| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.218592 |
| Chromosome: | chromosome 2 |
| Location: | 3270778 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095081 | (1 of 1) PF09295 - ChAPs (Chs5p-Arf1p-binding proteins) (ChAPs) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGAAGCTGCGCGTGGGCCGCGGCCTGCT |
| Internal bar code: | TGGGAGTTCGTCTTATACTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 228 |
| LEAP-Seq percent confirming: | 99.4798 |
| LEAP-Seq n confirming: | 1530 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCGTGGGTACATAGCTCG |
| Suggested primer 2: | TTCACATCGGGATTCCTAGC |