| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.218651 |
| Chromosome: | chromosome 17 |
| Location: | 3840426 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g727950 | RPN2 | 26S proteasome regulatory subunit; (1 of 1) K03032 - 26S proteasome regulatory subunit N2 (PSMD1, RPN2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGACCACATACTGTGTAACACACTAGC |
| Internal bar code: | GGGGTTGGAGAGACGGGACAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 949 |
| LEAP-Seq percent confirming: | 98.867 |
| LEAP-Seq n confirming: | 3316 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCCACAAGCCACCGATAC |
| Suggested primer 2: | ACCTGCTGGCTCTCATCAGT |