| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.218675 |
| Chromosome: | chromosome 13 |
| Location: | 1499427 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572700 | FAP66,FLA15,IFT144 | Intraflagellar transport protein 144; (1 of 1) PF04053//PF15911 - Coatomer WD associated region (Coatomer_WDAD) // WD domain, G-beta repeat (WD40_3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCTGGTCCCCGGATATCAAATGAAATGC |
| Internal bar code: | ACGGCAAATACGGAGTGGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 26.7682 |
| LEAP-Seq n confirming: | 492 |
| LEAP-Seq n nonconfirming: | 1346 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGCTGGTTAGTGGTCGT |
| Suggested primer 2: | CAACGAGATGGACACGTTTG |