Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.218773 |
Chromosome: | chromosome 11 |
Location: | 1017372 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467666 | LCI13,GT90F43,GT90-43 | Low-CO2-inducible 13; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAGCTTGATGATTACGTACTTCCGATTG |
Internal bar code: | TATTCTCCAACCGACTTATTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1401 |
LEAP-Seq percent confirming: | 99.5106 |
LEAP-Seq n confirming: | 1830 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTTTGCATTGGTTTCGGT |
Suggested primer 2: | CAATTGACAGCCTGACGCTA |