Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.218849 |
Chromosome: | chromosome 13 |
Location: | 4739693 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g604850 | (1 of 1) IPR026126 - BRISC and BRCA1-A complex member 1 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGCGACGGCGCGGTGCGGGCGCGGCGT |
Internal bar code: | GCACCAACCAGATGGGTAACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 655 |
LEAP-Seq percent confirming: | 37.931 |
LEAP-Seq n confirming: | 869 |
LEAP-Seq n nonconfirming: | 1422 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGCTTACTCCACACGACA |
Suggested primer 2: | TTCAAAATTCAAGCGTGCTG |