Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.218896 |
Chromosome: | chromosome 6 |
Location: | 6965577 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g296350 | SENP5,ULP1 | ULP2-type SUMO protease; (1 of 5) 3.4.22.68 - Ulp1 peptidase / Ulp1 protease | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCTCATGAATTGCAGGCACGTGCGGCTT |
Internal bar code: | CGGACGACGGCCCGCGAAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 285 |
LEAP-Seq percent confirming: | 99.8638 |
LEAP-Seq n confirming: | 2200 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCTCTGCTTCTCCTACCT |
Suggested primer 2: | TCATGTCGTGTTTCGCTCTC |