Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.218899 |
Chromosome: | chromosome 11 |
Location: | 3646269 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g482300 | FAP305,MOT17 | Motility 17; (1 of 1) PTHR22706:SF0 - SPERMATOGENESIS-ASSOCIATED PROTEIN 17 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGTGGGATGGTGTACGATGATGGCGGA |
Internal bar code: | ATTTTGTATGCTGCTTTACTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 166 |
LEAP-Seq percent confirming: | 98.2716 |
LEAP-Seq n confirming: | 398 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTAGGGTTGACCATGCCTC |
Suggested primer 2: | TTGGTGTGGACAAGAATGGA |