| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.218956 |
| Chromosome: | chromosome 12 |
| Location: | 3737447 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g514950 | CGLD17,HEL53 | (1 of 1) PTHR12873//PTHR12873:SF0 - T7-LIKE MITOCHONDRIAL DNA HELICASE // TWINKLE PROTEIN, MITOCHONDRIAL; Conserved in the Green Lineage and Diatoms | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGAAGTGTCCAGTTCTTTACGTATGGC |
| Internal bar code: | AGCGCTATGCTATTACGTATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 913 |
| LEAP-Seq percent confirming: | 64.8352 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCCCTGACAAGTGTATTT |
| Suggested primer 2: | CCTATCCATGGAAATCCCCT |