Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.219007 |
Chromosome: | chromosome 6 |
Location: | 2604382 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g269550 | COQ9 | Ubiquinone biosynthesis protein; (1 of 1) K18587 - ubiquinone biosynthesis protein COQ9 (COQ9) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCAAAATCTGAAGTTCGGAATCCGGAT |
Internal bar code: | CGGGACCCCGGCCAAGAGGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 513 |
LEAP-Seq percent confirming: | 99.4286 |
LEAP-Seq n confirming: | 348 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCCTCTTTGAAGTCGCTG |
Suggested primer 2: | GGAGAGGGAGGGAGTAGGTG |