| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.219050 |
| Chromosome: | chromosome 2 |
| Location: | 5275079 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106550 | (1 of 1) K12839 - survival of motor neuron-related-splicing factor 30 (SMNDC1, SPF30) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTTTCAACCGCGCACGCCTCCTCGCCAA |
| Internal bar code: | GTTCTTTCGAGATGTTTCACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1083 |
| LEAP-Seq percent confirming: | 91.0256 |
| LEAP-Seq n confirming: | 355 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGAGATTCCCAAGGTGTG |
| Suggested primer 2: | GAACAGCGCTCGTATCTTCC |