| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.219086 |
| Chromosome: | chromosome 14 |
| Location: | 153066 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608700 | ADT1 | (1 of 1) 2.6.1.39 - 2-aminoadipate transaminase / 2-aminoadipate aminotransferase; Putative 2-aminoadipate/L-kynurenine transaminase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGACCAAACCCAAATGAAAGATGAAAGAA |
| Internal bar code: | GCCGCCGAATATGTTTGATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 909 |
| LEAP-Seq percent confirming: | 99.6158 |
| LEAP-Seq n confirming: | 16854 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGAACGGATAGGAGAGG |
| Suggested primer 2: | TGTGACACAGTCAAGCCCTC |