| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.219150 |
| Chromosome: | chromosome 16 |
| Location: | 7488970 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687294 | FTRV1,FTRV | Ferredoxin Thioredoxin reductase, variable subunit%252C chloroplastic; (1 of 1) PTHR10949//PTHR10949:SF11 - LIPOYL SYNTHASE // SUBFAMILY NOT NAMED | 3'UTR |
| Cre16.g687406 | POB20 | Proteome of basal body 20 | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAGCAGACACACGGGATTCGTCTTCTGC |
| Internal bar code: | GCCAGACGCTGGTATTTCAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 790 |
| LEAP-Seq percent confirming: | 99.7741 |
| LEAP-Seq n confirming: | 2208 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAAAGGACGTCACCCACT |
| Suggested primer 2: | CGCTCGCTTGTCTACTACCC |