| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.219296 |
| Chromosome: | chromosome 6 |
| Location: | 2122455 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265550 | CDPK12 | (1 of 1) PF07714//PF13202 - Protein tyrosine kinase (Pkinase_Tyr) // EF hand (EF-hand_5); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCAACTTCGCTCGTTCTTCATTAATCA |
| Internal bar code: | TACTCGGTTTCGGGTACTAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 99.186 |
| LEAP-Seq n confirming: | 6214 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGCACTCGGTGACTCATA |
| Suggested primer 2: | GGAAAAAGCGACATTGGTGT |