| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219300 |
| Chromosome: | chromosome 6 |
| Location: | 2385980 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267800 | MML1,MITC8,MCP8 | (1 of 1) K15119 - solute carrier family 25, member 39/40 (SLC25A39_40); MTM-Like Mn transporter 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCTCCGGCTCACCGCGACAGCAGGCAG |
| Internal bar code: | GGACGAAGGCGATTGACTCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 605 |
| LEAP-Seq percent confirming: | 99.5039 |
| LEAP-Seq n confirming: | 3610 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAAGCATTGTGGTGGCAT |
| Suggested primer 2: | AAGAACACAACGATCGGGTC |