| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.219333 |
| Chromosome: | chromosome 4 |
| Location: | 239516 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217450 | (1 of 1) PF04979 - Protein phosphatase inhibitor 2 (IPP-2) (IPP-2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCAAGCAACCCACTACCCGGGACCAGCC |
| Internal bar code: | ACCGCGTGGCAGGTAACGTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 707 |
| LEAP-Seq percent confirming: | 84.9801 |
| LEAP-Seq n confirming: | 12153 |
| LEAP-Seq n nonconfirming: | 2148 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCGGTGCATTTACATTT |
| Suggested primer 2: | GAGGGCGTCCTATCTTGTTG |