| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.219387 |
| Chromosome: | chromosome 3 |
| Location: | 6590340 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g196250 | CEP3 | Cysteine endopeptidase; (1 of 1) 3.4.22.1 - Cathepsin B / Cathepsin B1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCGTACACGTAACACCGCTCCTGCCGTA |
| Internal bar code: | AGGTGCTGGGTTCATGGAGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 670 |
| LEAP-Seq percent confirming: | 99.8462 |
| LEAP-Seq n confirming: | 7788 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATCACGTTACGAGCTGAA |
| Suggested primer 2: | GCATCTGCAATCTTGCGTTA |