| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.219400 |
| Chromosome: | chromosome 17 |
| Location: | 3364358 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g723600 | IFT81,FLA9 | Intraflagellar Transport Protein 81; (1 of 1) IPR029600 - Intraflagellar transport protein 81 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCGCCTGAACGCACCGTCCCCGCTGAC |
| Internal bar code: | GAAGGGTGCGAAAGTGTACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 822 |
| LEAP-Seq percent confirming: | 98.8801 |
| LEAP-Seq n confirming: | 4768 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTGGCACGCTTAACTAGC |
| Suggested primer 2: | TGCAGCATGTGGTATTTGGT |