| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219447 |
| Chromosome: | chromosome 16 |
| Location: | 4030119 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670200 | Microtubule-associated protein cysteine-rich PDZ-binding protein; (1 of 2) PTHR11805:SF1 - CYSTEINE-RICH PDZ-BINDING PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGAAACAGCCCCGCCCACGGTCAAAAC |
| Internal bar code: | TGGGTAAGAGTGATTAAAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1020 |
| LEAP-Seq percent confirming: | 99.4158 |
| LEAP-Seq n confirming: | 2042 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGTTAATGGGCTGTCAT |
| Suggested primer 2: | AATGCAAGACGTGCAAACAG |