| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219453 |
| Chromosome: | chromosome 16 |
| Location: | 91845 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g695600 | DNJ10 | DnaJ-like protein and Myb-like transcription factor; (1 of 1) PTHR24078:SF307 - MOLECULAR CHAPERONE HSP40/DNAJ-LIKE PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTAGGCCTTGAGTCGGAGTCAGCTACCA |
| Internal bar code: | TGCCCGGCTCACGGACGTTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 743 |
| LEAP-Seq percent confirming: | 95.343 |
| LEAP-Seq n confirming: | 1904 |
| LEAP-Seq n nonconfirming: | 93 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTTTGGGAACACTGCGTA |
| Suggested primer 2: | TTTAGGGACCACCGACTACG |