| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.219460 |
| Chromosome: | chromosome_8 |
| Location: | 1042516 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre08.g362100 | FAL11 | Similar to Flagellar Associated Protein FAP154 | antisense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | TGCGCTCTAGTTTTTGCGTTTTTGGTGCCA |
| Internal bar code: | ATGAAAGGTATCGTGTGAAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 719 |
| LEAP-Seq percent confirming: | 99.6004 |
| LEAP-Seq n confirming: | 997 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGTCAAGTGGAGCAATGA |
| Suggested primer 2: | GAGCACTCAGGGGAGCATAG |