Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.219484 |
Chromosome: | chromosome 1 |
Location: | 1768782 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g009500 | CDPK3,CDPK5 | Calcium/calmodulin-dependent protein kinase; (1 of 2) PF00069//PF13499 - Protein kinase domain (Pkinase) // EF-hand domain pair (EF-hand_7) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGTTGGGGCAGCGAGAGCAGGAGGTTA |
Internal bar code: | GAGGACGAGAGCCCGTTCTCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 9792 |
LEAP-Seq percent confirming: | 96.5638 |
LEAP-Seq n confirming: | 10735 |
LEAP-Seq n nonconfirming: | 382 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATAACTCCCGCCACAACAAG |
Suggested primer 2: | TCATGCACCGAGAGTGAGTC |