Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.219511 |
Chromosome: | chromosome 6 |
Location: | 5241111 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g282251 | (1 of 12) IPR000104//IPR002893 - Antifreeze protein, type I // Zinc finger, MYND-type | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGCTGCTCGAGGGGGGAGTGTTGAGGAG |
Internal bar code: | TTGGGCTCTGAATTGGCTAGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 93 |
LEAP-Seq percent confirming: | 97.2561 |
LEAP-Seq n confirming: | 319 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCACATCCCCGAAGAAGAC |
Suggested primer 2: | GCATGTGTGTACGGTGTGTG |