| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.219527 |
| Chromosome: | chromosome 6 |
| Location: | 5445862 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284350 | CYCD3 | (1 of 1) K18810 - cyclin D1/2/4, plant (CYCD1_2_4); D-type cyclin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACAGTGTGGCAGGGGCCTGCACGGTCC |
| Internal bar code: | GGGGCTAGGACGGAATTCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 591 |
| LEAP-Seq percent confirming: | 56.2258 |
| LEAP-Seq n confirming: | 1016 |
| LEAP-Seq n nonconfirming: | 791 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTGCCGACCACCTGATAC |
| Suggested primer 2: | TTCACCAGTCACGCAAGAAG |