| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.219542 |
| Chromosome: | chromosome 10 |
| Location: | 2097018 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433350 | (1 of 19) PTHR31251:SF1 - SQUAMOSA PROMOTER-BINDING-LIKE PROTEIN 10-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGTAGGGATCACAGAAGGAGGGCTGCTG |
| Internal bar code: | AGCTCGATGGACTCGGCGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 825 |
| LEAP-Seq percent confirming: | 99.4186 |
| LEAP-Seq n confirming: | 3249 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTAACATCCGAACACCTT |
| Suggested primer 2: | TACTGACTCCGAGCACAACG |